Collected in the mountains of Boulder Colorado near 10k ft elevation.
Spores:
(11.6) 11.7 - 13.6 (15.8) × (6.5) 6.7 - 7.6 (8.2) µm
Q = (1.6) 1.62 - 1.89 (1.9) ; N = 13
Me = 12.7 × 7.2 µm ; Qe = 1.8
11.89 7.21
13.19 7.14
13.53 7.31
12.42 7.57
11.61 6.51
11.85 7.62
13.64 7.21
12.25 6.76
15.82 8.18
12.05 7.45
11.73 6.65
12.47 7.22
12.29 6.75
Found from 9/12/23-10/7/23
at a little over 9K ft elevation.
Quite variable.
Caps; tan and campanulate to grey or muddy brown and umbonate, or sometimes slightly depressed. Often hygrophanous, occasionally striate, particularly in darker specimens, ~.5 - 4 cm across
Stipes; small and whitish grey, fragile, and relatively rough in texture. Heavily myceliated at base. Rarely bruising visibly blue, more often a darker maroon or little to no noticeable color change.
Substrate and growth tendencies also varied, as shown in photos. Small caespitose clusters or singular growth found on a variety of hosts including dwarf willow, Doug fir, lodgepole pine, and seemingly an Aspen or two. The largest flushes though, seemed to be in gregarious troops spreading terrestrially across vegetative debris (mostly conifer needles and cones). Always within 10 ft or so of water, usually closer and sometimes almost touching. All of these were found near a creek.
They were definitely experiencing temps dipping below freezing at night, particularly toward the end of my finding them in early October.
Tomentose, leaves are reminiscent of sagebrush, herbaceous.
Poor photo, but posting anyway as this wolf was sited only a few days after wolf reintroduction to Colorado, per news reports, and not in this county. Wolf was 200 yards from road, and within site of a herd of mule deer. Looked healthy, immediately perked ears and ran in opposite direction when it saw us.
Fluorescent in ultraviolet light, under oak and white pine.
Growing near Pinus ponderosa and Quercus gambelii.
Staining blue where damaged. Growing in a wet grassy area near ponderosa pine.
ITS sequence: CTTTGGCGTGGTTGTAGCTGGCCCTCTCGGGGGCATGTGCCCACTATGTCATCTTTATATCTCCACCTGTGCACCCTTTGTAGAACGTTTTTGGACTGATAGGAGTGAGACTCGCAAGAGTTGACCAAGTTGAACGTCCTGAACGGTCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATCATATGGCCTAGTGCCTATAAACTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTCGTGTAATGGCTTGGACTTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCAACTCCCCTTAAATGCATTAGCCGGCTTCCCCGCGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACAATCTGCTTTAATGGGTTGAAGCTGCTTCTAACCGTCTATTAAGTTGGACAATACATATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTAC
200 bp match 100% with Psilocybe quebecensis in GenBank, however that sequence is short and a longer reference sequence is needed to be sure of the match.
Subalpine spruce-fir forest; on soil. Velvety cap, yellow pores bruising blue
Growing from a cut but resprouting stump of green ash, Fraxinus pennsylvanica. This is the second time this stump fruited that I know of, the first being in 2016. Will preserve a specimen to send to the Sam Mitchel Herbarium of Fungi in Denver. Hoping to get a sample sequenced as well.